Tutoriel par Examples: awk



Lecture ligne par ligne awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' < input.fa on peut lire ce script awk comme: si la ligne en cours ( $0 ) commence comme un en-tête fasta ( ^> ). E...
$ gunzip -c input.fastq.gz | awk '{printf("%s%s",$0,((NR+1)%4==1?"\n":"\t"));}' | head @IL31_4368:1:1:996:8507/2 TCCCTTACCCCCAAGCTCCATACCCTCCTAATGCCCACACCTCTTACCTTAGGA + FFCEFFFEEFFFFFFFEFFEFFFEFCFC<EEFEFFFCEFF<;EEFF=FEE?FCE @IL31_4368:1:1:996:21421/2...
Si le programme est court, vous pouvez l'inclure dans la commande qui exécute awk: awk -F: '{print $1, $2}' /etc/passwd Dans cet exemple, en utilisant le commutateur de ligne de commande -F: nous recommandons à awk d’utiliser: comme délimiteur de champs d’entrée. Est-ce la même chose awk 'BEG...
AWK est un langage de manipulation de chaînes, largement utilisé dans les systèmes UNIX. L'idée derrière AWK était de créer un langage polyvalent à utiliser pour travailler sur des fichiers, ce qui n'était pas trop complexe à comprendre. AWK a d'autres variantes, mais le concept princi...
J'espère que cet exemple aidera tout le monde à comprendre comment les variables internes telles que NR, FNR, etc. changent lorsque awk traite deux fichiers. awk '{print "NR:",NR,"FNR:",FNR,"fname:",FILENAME,"Field1:",$1}' file1 file2 NR: 1 FNR: 1 fname:...

Page 1 de 1